Bio.Restriction.PrintFormat module
Print the results of restriction enzyme analysis.
PrintFormat prints the results from restriction analysis in 3 different format: list, column or map.
The easiest way to use it is:
>>> from Bio.Restriction.PrintFormat import PrintFormat
>>> from Bio.Restriction.Restriction import RestrictionBatch
>>> from Bio.Seq import Seq
>>> pBs_mcs = Seq('GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTC')
>>> restriction_batch = RestrictionBatch(['EcoRI', 'BamHI', 'ApaI'])
>>> result = restriction_batch.search(pBs_mcs)
>>> my_map = PrintFormat()
>>> my_map.print_that(result, 'My pBluescript mcs analysis:\n',
... 'No site:\n')
My pBluescript mcs analysis:
ApaI : 12.
EcoRI : 50.
No site:
BamHI
>>> my_map.sequence = pBs_mcs
>>> my_map.print_as("map")
>>> my_map.print_that(result)
12 ApaI
|
| 50 EcoRI
| |
GGTACCGGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTTGATATCGAATTC
||||||||||||||||||||||||||||||||||||||||||||||||||||||
CCATGGCCCGGGGGGGAGCTCCAGCTGCCATAGCTATTCGAACTATAGCTTAAG
1 54
Enzymes which do not cut the sequence.
BamHI
>>>
Some of the methods of PrintFormat are meant to be overridden by derived class.
Use the following parameters to control the appearance:
- ConsoleWidthwidth of the console used default to 80.
should never be less than 60.
NameWidth : space attributed to the name in PrintList method.
Indent : Indent of the second line.
- MaxSizeMaximal size of the sequence (default=6:
-> 99 999 bp + 1 trailing ‘,’ people are unlikely to ask for restriction map of sequences bigger than 100.000 bp. This is needed to determine the space to be reserved for sites location.
MaxSize = 5 => 9.999 bp
MaxSize = 6 => 99.999 bp
MaxSize = 7 => 999.999 bp
Example output:
<------------ ConsoleWidth --------------->
<- NameWidth ->
EcoRI : 1, 45, 50, 300, 400, 650,
700, 1200, 2500.
<-->
Indent
- class Bio.Restriction.PrintFormat.PrintFormat
Bases:
objectPrintFormat allow the printing of results of restriction analysis.
- ConsoleWidth = 80
- NameWidth = 10
- MaxSize = 6
- Cmodulo = 0
- PrefWidth = 80
- Indent = 4
- linesize = 70
- print_as(what='list')
Print the results as specified.
- Valid format are:
‘list’ -> alphabetical order ‘number’ -> number of sites in the sequence ‘map’ -> a map representation of the sequence with the sites.
If you want more flexibility over-ride the virtual method make_format.
- format_output(dct, title='', s1='')
Summarise results as a nicely formatted string.
- Arguments:
dct is a dictionary as returned by a RestrictionBatch.search()
title is the title of the map. It must be a formatted string, i.e. you must include the line break.
s1 is the title separating the list of enzymes that have sites from those without sites.
s1 must be a formatted string as well.
The format of print_that is a list.
- print_that(dct, title='', s1='')
Print the output of the format_output method (OBSOLETE).
- Arguments:
dct is a dictionary as returned by a RestrictionBatch.search()
title is the title of the map. It must be a formatted string, i.e. you must include the line break.
s1 is the title separating the list of enzymes that have sites from those without sites.
s1 must be a formatted string as well.
This method prints the output of A.format_output() and it is here for backwards compatibility.
- make_format(cut=(), title='', nc=(), s1='')
Virtual method used for formatting results.
Virtual method. Here to be pointed to one of the _make_* methods. You can as well create a new method and point make_format to it.
- __annotations_cache__ = {}
- __firstlineno__ = 85
- __static_attributes__ = ('make_format',)